Sequence ID | >WENV170001003 |
Genome ID | AGBJ01000326 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4297 |
End posion on genome | 4371 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gtttttcgtg |
tRNA gene sequence |
GTGGATGTAGTTCAGCGGTAGAGCACCGGATTGTGGTTCCGGTTGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
ttttgctatt |
Secondary structure (Cloverleaf model) | >WENV170001003 His GTG g CCCA ttttgctatt G - C T - A G - C G - C A - T T - A G - C T A T T A C C C A G A A + | | | | A C C T T G G T G G G C G | | + | T T G G A G C T A A TTGTC C - G C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |