Sequence ID | >WENV170001063 |
Genome ID | AGBJ01001890 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 716 |
End posion on genome | 802 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttagctactt |
tRNA gene sequence |
GCCGGGATGGTGAAATTGGCAAACGCAGGGGATTCAAAATCCCCCGGGCTTCGGCCCCTG |
Downstream region at tRNA end position |
aatatcaaaa |
Secondary structure (Cloverleaf model) | >WENV170001063 Leu CAA t ACAA aatatcaaaa G + T C - G C - G G - C G + T G - C A - T T A T C T C C C A T A A G | | | | | A T A G T G G A G G G C G | + | T T G A C G C C A A A CGGGCTTCGGCCCCT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |