Sequence ID | >WENV170001074 |
Genome ID | AGBJ01002616 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 708 |
End posion on genome | 781 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tataaacatt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTTGTCTGGCAGACAAGAGGTCACGGGTTCGAGC |
Downstream region at tRNA end position |
ttttcacctt |
Secondary structure (Cloverleaf model) | >WENV170001074 Ala GGC t ACtt ttttcacctt G - C G - C G + T G - C C - G C - G A - T C G T T G C C C A C G A A | | | | | G T C T C G A C G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C T - A C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |