Sequence ID | >WENV170001092 |
Genome ID | AGBJ01003816 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 700 |
End posion on genome | 623 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tattttttac |
tRNA gene sequence |
GGGCTTGTAGCTCAGTCTGGTTAGAGCACCGTGCTGATAACGCGGGAGTCGGTGGTTCAA |
Downstream region at tRNA end position |
ataaaagtaa |
Secondary structure (Cloverleaf model) | >WENV170001092 Ile GAT c ACCT ataaaagtaa G - C G - C G - C C - G T + G T - A G - C T C T C C A C C A C T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A A GAGTC C - G C - G G - C T + G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |