Sequence ID | >WENV170001098 |
Genome ID | AGBJ01004382 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 83 |
End posion on genome | 9 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
acgaagtttG |
tRNA gene sequence |
CCCTACATAGCTCAGGTGGTAGAGCACGTTCTTGGTAAGAACGGGGTCACCAGTTCGAAT |
Downstream region at tRNA end position |
caaactnnnn |
Secondary structure (Cloverleaf model) | >WENV170001098 Thr GGT G TAgg caaactnnnn C C C - G C - G T + G A - T C - G A - T T A T T G G T C A G G A A | | | | | G T C T C G A C C A G C G | | | | T T G G A G C T A A GGGTC C - G G - C T - A T - A C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |