Sequence ID | >WENV170001115 |
Genome ID | AGBJ01005237 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 4 |
End posion on genome | 80 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnnnncct |
tRNA gene sequence |
GGGCGATTAACTCAGATGGCAAGAGTGTTTCCCTTACAAGGAAGAAGTCATAGGTTCGAG |
Downstream region at tRNA end position |
ttttttacct |
Secondary structure (Cloverleaf model) | >WENV170001115 Val TAC t ACCT ttttttacct G - C G - C G - C C - G G - C A - T T - A T G T T A T C C A A G A A | | | | | G T C T C A A T A G G C G | | | | T T G G A G T C A A G AAGTC T + G T - A T - A C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |