Sequence ID | >WENV170001129 |
Genome ID | AGBJ01006416 |
Phylum/Class | [AGBJ] hypersaline lake metagenome; upper interface of the deep-sea hypersaline anoxic lake (DHAL) Thetis located South-East |
Species | |
Start position on genome | 339 |
End posion on genome | 415 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atatgaagaa |
tRNA gene sequence |
GCGCTTGTGGCTCAATTGGATAGAGCATCAGACTTCGGATCTGAGGGTTAGAGGTTCGAG |
Downstream region at tRNA end position |
tttaatgtat |
Secondary structure (Cloverleaf model) | >WENV170001129 Arg TCG a ACCA tttaatgtat G + T C - G G - C C - G T + G T - A G - C T G T T C T C C A T A A G | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |