Sequence ID | >WENV170001163 |
Genome ID | AGBK01000056 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1886 |
End posion on genome | 1962 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tattctctga |
tRNA gene sequence |
GCGGCCGTGGTCCAGTTTGGCTAAGACTCTGGCTTCCCATGCCAGCAACGCGGGTTCAAA |
Downstream region at tRNA end position |
tttcttatcg |
Secondary structure (Cloverleaf model) | >WENV170001163 Gly CCC a ATCA tttcttatcg G - C C - G G - C G - C C - G C - G G - C T A T C G C C C A T T G A G | | | | | A T C C T G G C G G G C G | | | T T G A G A C C T A T CAAC C - G T - A G - C G - C C - G T T T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |