Sequence ID | >WENV170001180 |
Genome ID | AGBK01000464 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 1063 |
End posion on genome | 1150 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
accagatttg |
tRNA gene sequence |
GCCGGGGTGGCGGAATTGGCAGACGCAAGGGACTTAAAATCCCTTGGGGTAATGTACCCC |
Downstream region at tRNA end position |
aacctcatcc |
Secondary structure (Cloverleaf model) | >WENV170001180 Leu TAA g ACtc aacctcatcc G - C C - G C - G G - C G - C G - C G - C T G T C G C C C A T A A G | | | | | A T G G C G G C G G G C G | | | T T G A C G C C A G A TGGGGTAATGTACCCCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |