Sequence ID | >WENV170001189 |
Genome ID | AGBK01000718 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 226 |
End posion on genome | 312 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tattctgcct |
tRNA gene sequence |
GCCGGGGTGGCAGAATCTGGCAATGCGCCGGCTTGGAGAGCCGGTGGCCGCTTTAGGCCT |
Downstream region at tRNA end position |
tacaatcatc |
Secondary structure (Cloverleaf model) | >WENV170001189 Ser GGA t GCtt tacaatcatc G - C C - G C - G G - C G - C G - C G - C T A T G A C C C A T A A G | | | | | G C G A C G C T G G G C T | | | T T G A T G C G C A G TGGCCGCTTTAGGCCTT C - G C - G G - C G - C C - G T A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |