Sequence ID | >WENV170001196 |
Genome ID | AGBK01000775 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 209 |
End posion on genome | 284 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taatttatgc |
tRNA gene sequence |
GGGCCCGTAGTCTAGTGGCTATGACGTCACCCTTACAAGGTGAAGGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
attatttttg |
Secondary structure (Cloverleaf model) | >WENV170001196 Val TAC c ATCA attatttttg G - C G - C G - C C - G C - G C - G G - C T A T C T C C C A T G A A | | | | | G G T C T G G A G G G C G | | | T T C T G A C T A G AGGTC T - A C - G A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |