Sequence ID | >WENV170001229 |
Genome ID | AGBK01003231 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 442 |
End posion on genome | 369 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtttaggcta |
tRNA gene sequence |
GGGTCCGTGGTCTAGTTGGTTAGGACGTCGCCCTTACAAGGCGAAGATCGCTGGTTCGAA |
Downstream region at tRNA end position |
gggtattttt |
Secondary structure (Cloverleaf model) | >WENV170001229 Val TAC a Atat gggtattttt G - C G - C G - C T - A C - G C - G G - C C A T C G G C C A T G A G | | + | | G T T C T G G C T G G C G + | | | T T G G G A C T T A G AGATC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |