Sequence ID | >WENV170001234 |
Genome ID | AGBK01004102 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 410 |
End posion on genome | 483 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
attaaccgat |
tRNA gene sequence |
GCCTCGGTAGCTCAGCTGGCTAGAGCGACTCCCTTGTAAGGAGTAGGCCGTGGGTTCAAA |
Downstream region at tRNA end position |
atgtgatcgg |
Secondary structure (Cloverleaf model) | >WENV170001234 Thr TGT t Ttac atgtgatcgg G - C C - G C - G T + G C - G G - C G - C T A T C A C C C A C G A A | | | | | A T C T C G G T G G G C G | | | | T T G G A G C C T A G AGGCC A - T C - G T - A C - G C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |