Sequence ID | >WENV170001244 |
Genome ID | AGBK01005231 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 110 |
End posion on genome | 37 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tctgcatgtg |
tRNA gene sequence |
GCCGAGGTGGGGTAGTGGCTTAACCTTCGGGACTGTGGCTCCCGCGCCCTGGGTTCGAAT |
Downstream region at tRNA end position |
acattacact |
Secondary structure (Cloverleaf model) | >WENV170001244 His GTG g CCtt acattacact G - C C - G C - G G + T A - T G - C G - C T A T G G C C C A T G A G | + | | | G G T G G G C T G G G C G | | | + T T C A C C T T T A T CGCC C - G G - C G - C G - C A - T C C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |