Sequence ID | >WENV170001296 |
Genome ID | AGBK01012100 |
Phylum/Class | [AGBK] hypersaline lake metagenome; extremely saline anoxic brine of the deep-sea hypersaline anoxic lake (DHAL) Thetis located |
Species | |
Start position on genome | 115 |
End posion on genome | 202 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcttgcaatt |
tRNA gene sequence |
GCGAAGGTGGCGGAATCGGCAGACGCGCTAGGTTTAGGACCTAGTGGGGTTTTCCCCGTG |
Downstream region at tRNA end position |
gtacaaatga |
Secondary structure (Cloverleaf model) | >WENV170001296 Leu TAG t ACCA gtacaaatga G - C C - G G - C A - T A - T G - C G - C T G T C G C C C A T A A G | | | | A C G G C G A C G G G C G | | | T T G A C G C C A G G TGGGGTTTTCCCCGTG C - G T - A A - T G - C G - C T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |