The detailed information of tRNA gene sequence


Sequence ID>WENV170003822
Genome IDAGTN01461294
Search identical group
Phylum/Class[AGTN] bioreactor metagenome; poplar biomass
Species
Start position on genome 396
End posion on genome 471
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
agggtcggag
tRNA gene sequence
GGGGCTGTAGCTCAGCTGGGAGAGCGCCTCGTTCGCAATGAGGAGGTCAGGGGTTCGATC
CCCCTCAGCTCCACCA
Downstream region at tRNA end position
accaccccga
Secondary structure (Cloverleaf model)
>WENV170003822	Ala	CGC
                   g      ACCA accaccccga
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     T - A
                     G - C          C T
                    T     T C C C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G G G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    C - G
                    T - A
                    C - G
                    G + T
                  T       A
                  T       A
                    C G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK