Sequence ID | >WENV170004659 |
Genome ID | AHKK01001637 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 278 |
End posion on genome | 354 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cctcaatgtt |
tRNA gene sequence |
GCCCACGTAGCTCAGTCGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTTCACCGGTTCGAT |
Downstream region at tRNA end position |
ttatatataa |
Secondary structure (Cloverleaf model) | >WENV170004659 Thr GGT t TCCA ttatatataa G - C C - G C - G C - G A - T C - G G - C C T T T G G C C A T G A A | | | | | G C C T C G A C C G G C G | | | | T T G G A G C T A G AGGTTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |