Sequence ID | >WENV170004673 |
Genome ID | AHKK01005444 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 616 |
End posion on genome | 691 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
gccttttcgc |
tRNA gene sequence |
GCCCTCGTGGCTCAGTGGATAGAGCGTCTGGTTGCGGACCAGAAAGTCACAGGTTCAAAT |
Downstream region at tRNA end position |
tttgtaggtc |
Secondary structure (Cloverleaf model) | >WENV170004673 Arg GCG c ACTA tttgtaggtc G + T C - G C - G C - G T - A C - G G - C T A T T G T C C A T G A G | | | | | A G C T C G A C A G G C G | | | | T T A G A G C T A G AAGTC T - A C - G T - A G - C G - C T A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |