Sequence ID | >WENV170004700 |
Genome ID | AHKK01007925 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 309 |
End posion on genome | 381 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tattcagatc |
tRNA gene sequence |
GGGGACGTAGCTCAGTCGGTAGAGCGGTTGTTTCGCGTATGACAGGTCCTAGGTTCGATC |
Downstream region at tRNA end position |
tttatggata |
Secondary structure (Cloverleaf model) | >WENV170004700 Ala CGC c Aatg tttatggata G - C G - C G + T G - C A - T C - G G - C C T T G A T C C A T G A A | | | | | G C C T C G C T A G G C G | | | | T T G G A G C T A G AGGTC G - C T - A T + G G + T T - A T T T G C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |