Sequence ID | >WENV170004703 |
Genome ID | AHKK01008252 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 288 |
End posion on genome | 373 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agaaatagaT |
tRNA gene sequence |
GCGGGGGTTGCTGAGCTAGGAAAAGGCACAGGGCTTAGGACCCTGTCTCGTAGGAGTCCG |
Downstream region at tRNA end position |
atttacctgt |
Secondary structure (Cloverleaf model) | >WENV170004703 Leu TAG T ATag atttacctgt G - C C - G G - C G - C G - C G - C G - C T A T C G C A C A T C G A T | | | | | A A G T C G G C G T G C G + | | T T G A G G C A A A A TCTCGTAGGAGTCC C - G A - T G - C G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |