Sequence ID | >WENV170004755 |
Genome ID | AHKK01012577 |
Phylum/Class | [AHKK] sediment metagenome; Nyegga cold-seep field located at the mid-Norwegian margin on the northern edge of the Storegga |
Species | |
Start position on genome | 126 |
End posion on genome | 43 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cttaagcaaa |
tRNA gene sequence |
GCGGGGGTAGCCGAGCTGGACAAAGGCGCAGGACTTAAGATCCTGTTCCGTAGGGATACG |
Downstream region at tRNA end position |
ttttacttct |
Secondary structure (Cloverleaf model) | >WENV170004755 Leu TAA a Atga ttttacttct G - C C - G G - C G - C G - C G - C G - C T A T C T C C C A T C G A A | | | | G G G C C G G T G G G C G | | | T T A A G G C C A A G TTCCGTAGGGATAC C - G A - T G - C G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |