| Sequence ID | >WENV170008375 |
| Genome ID | AOMP01001102 |
| Phylum/Class | [AOMP] mine drainage metagenome; low temperature acidic, metal-polluted mine stream |
| Species | |
|
Start position on genome
|
900
|
|
End posion on genome
|
825
|
|
Amino Acid
|
Met
|
|
Anticodon
|
CAT
|
|
Upstream region at tRNA start position
|
gcctcaaaac
|
|
tRNA gene sequence
|
GGACAATTAGCTCAGTTGGCAGAGCAATGGAATCATAACCCATGGGTCGCCAGTTCGATT CTGGCATTGTCCACCA
|
|
Downstream region at tRNA end position
|
tgcaggttta
|
| Secondary structure (Cloverleaf model) | >WENV170008375 Met CAT
c ACCA tgcaggttta
G - C
G - C
A - T
C - G
A - T
A - T
T - A T T
T C G G T C A
T G A A | | | | | G
T C T C G G C C A G C
G | | | | T T
G G A G C
C A A GGGTC
A - T
T - A
G - C
G - C
A C
A A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |