Sequence ID | >WENV170012452 |
Genome ID | ASRK01000349 |
Phylum/Class | [ASRK] bioreactor metagenome; day 48 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4004 |
End posion on genome | 4079 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
acatgtaatT |
tRNA gene sequence |
GCAGGCATGGCTCAATTGGATAGAGCATCTGACTTCGGATCAGAGGGTTGTGGGTTCAAG |
Downstream region at tRNA end position |
aagaaaaaga |
Secondary structure (Cloverleaf model) | >WENV170012452 Arg TCG T GTat aagaaaaaga G - C C - G A - T G - C G - C C - G A - T T G T C A T C C A T A A G | | + | | A T C T C G G T G G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G T - A G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |