Sequence ID | >WENV170012563 |
Genome ID | ASRL01001856 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1205 |
End posion on genome | 1280 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agtttactat |
tRNA gene sequence |
GCCGCTTTAGCTCATCTGGTAGAGCAACTGACTTGTAATCAGTAGGTGATTGGTTCGACT |
Downstream region at tRNA end position |
taatttaaat |
Secondary structure (Cloverleaf model) | >WENV170012563 Thr TGT t ACCA taatttaaat G - C C - G C - G G - C C - G T - A T - A T C T T A G C C A C T A A | | + | | G T C T C G A T T G G C G | | | | T T G G A G C T A A AGGTG A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |