Sequence ID | >WENV170012573 |
Genome ID | ASRL01003158 |
Phylum/Class | [ASRL] bioreactor metagenome; day 67 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 148 |
End posion on genome | 76 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aacttcatat |
tRNA gene sequence |
GCCGACGTGGCTCAATTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTATCGGTTCGAGT |
Downstream region at tRNA end position |
attatttatt |
Secondary structure (Cloverleaf model) | >WENV170012573 Thr TGT t Tttg attatttatt G - C C - G C - G G - C A - T C - G G - C T G T T A G C C A T A A G | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |