Sequence ID | >WENV170012602 |
Genome ID | ASRM01001338 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1007 |
End posion on genome | 931 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agaaatttac |
tRNA gene sequence |
GTCAGTATAGCTCAGTTGGTTAGAGCGCGGGATTCATAACCCCGAGGTCGGTGGTTCAAC |
Downstream region at tRNA end position |
aataaaaatt |
Secondary structure (Cloverleaf model) | >WENV170012602 Met CAT c ACCA aataaaaatt G - C T - A C - G A - T G + T T - A A - T T C T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |