Sequence ID | >WENV170012629 |
Genome ID | ASRM01005616 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 548 |
End posion on genome | 623 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gaaagaccat |
tRNA gene sequence |
GGGTGATTAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
taatctttca |
Secondary structure (Cloverleaf model) | >WENV170012629 Val TAC t ACCA taatctttca G - C G - C G - C T - A G - C A - T T - A C T T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |