Sequence ID | >WENV170012648 |
Genome ID | ASRM01018229 |
Phylum/Class | [ASRM] bioreactor metagenome; day 74 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 280 |
End posion on genome | 206 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnngtagat |
tRNA gene sequence |
TCCGGCATAGCTCAGCGGTAGAGTAGGTGACTGTTAATCACTTGGTCCCAGGTTCGAATC |
Downstream region at tRNA end position |
cattcatttt |
Secondary structure (Cloverleaf model) | >WENV170012648 Asn GTT t GCCA cattcatttt T - A C - G C - G G - C G - C C - G A - T T A T G G T C C A G A A | | | | | G C C T C G C C A G G C G | | | + T T G G A G T T A A TGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |