Sequence ID | >WENV170012680 |
Genome ID | ASRN01000632 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 4145 |
End posion on genome | 4070 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gccccgttga |
tRNA gene sequence |
GCCCGGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
tatttaaaaa |
Secondary structure (Cloverleaf model) | >WENV170012680 Phe GAA a ACCA tatttaaaaa G - C C - G C - G C - G G - C G - C A - T T T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |