Sequence ID | >WENV170012701 |
Genome ID | ASRN01002299 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 237 |
End posion on genome | 161 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttttctttta |
tRNA gene sequence |
CCGCCCTTAGCTCAGCTGGATAGAGCAATCCCCTCCTAAGGGATAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
tttttatagc |
Secondary structure (Cloverleaf model) | >WENV170012701 Arg CCT a GCCA tttttatagc C - G C - G G - C C - G C - G C - G T - A T A T C G T C C A C G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC A - T T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |