Sequence ID | >WENV170012706 |
Genome ID | ASRN01002913 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 123 |
End posion on genome | 198 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
gcaatgttct |
tRNA gene sequence |
AGGCCAGTAGCTCAATTGGCAGAGCGACGGTCTCCAAAACCGTAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
gcttttaaat |
Secondary structure (Cloverleaf model) | >WENV170012706 Trp CCA t GCCA gcttttaaat A - T G - C G - C C - G C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |