Sequence ID | >WENV170012709 |
Genome ID | ASRN01003318 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 876 |
End posion on genome | 792 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgagtaacat |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTAGACACACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAG |
Downstream region at tRNA end position |
tctagaggct |
Secondary structure (Cloverleaf model) | >WENV170012709 Leu TAG t ACCA tctagaggct G - C C - G G - C G - C A - T C - G G + T T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G A CGCCGCGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |