Sequence ID | >WENV170012715 |
Genome ID | ASRN01003896 |
Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 654 |
End posion on genome | 729 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tccacgaaat |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAACGGTTCGATC |
Downstream region at tRNA end position |
ctttcttgat |
Secondary structure (Cloverleaf model) | >WENV170012715 Ala GGC t ACCA ctttcttgat G - C G - C G + T G - C C - G T - A A - T C T T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |