| Sequence ID | >WENV170012728 |
| Genome ID | ASRN01005716 |
| Phylum/Class | [ASRN] bioreactor metagenome; day 82 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
| Species | |
| Start position on genome | 70 |
| End posion on genome | 146 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
attttaatat |
| tRNA gene sequence |
GTCAAGGTAGCTCAGCTGGCTAGAGCGCTGGTCTCATAAGCCGGAGGTCGAGAGTTCAAG |
| Downstream region at tRNA end position |
tattaaaatt |
| Secondary structure (Cloverleaf model) | >WENV170012728 Met CAT
t ACCA tattaaaatt
G - C
T - A
C - G
A - T
A - T
G - C
G + T T G
T C T C T C A
C G A A | | | | | A
T C T C G G A G A G C
G | | | | T T
G G A G C
C T A G AGGTC
C - G
T + G
G - C
G - C
T + G
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |