Sequence ID | >WENV170012743 |
Genome ID | ASRO01000003 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 31223 |
End posion on genome | 31139 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
taaaaaacct |
tRNA gene sequence |
GCGGATGTGGTGAAATTGGTAGACACGCCAGACTTAGGATCTGGTGCCTCGCGGTGTGGA |
Downstream region at tRNA end position |
tttaaaacta |
Secondary structure (Cloverleaf model) | >WENV170012743 Leu TAG t ACCA tttaaaacta G - C C - G G - C G - C A - T T - A G - C T G T T C T C C A T A A G + | | | | G T A G T G G G A G G C G | | | T T G A C A C T A G G TGCCTCGCGGTGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |