Sequence ID | >WENV170012790 |
Genome ID | ASRO01001826 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1066 |
End posion on genome | 1142 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gtggagccat |
tRNA gene sequence |
CGGGGTATAGCGCAGTCCGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
ttttttgggt |
Secondary structure (Cloverleaf model) | >WENV170012790 Pro TGG t ACCA ttttttgggt C - G G - C G - C G - C G - C T - A A - T T A T C C C C C A T G A A | | | | G C C G C G G G G A G C C | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |