Sequence ID | >WENV170012797 |
Genome ID | ASRO01002651 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 813 |
End posion on genome | 889 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgacctgtat |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCAAC |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170012797 Ile GAT t ACCA annnnnnnnn G - C G - C G - C T - A C - G T - A G - C T C T C C G T C A T G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |