Sequence ID | >WENV170012805 |
Genome ID | ASRO01003987 |
Phylum/Class | [ASRO] bioreactor metagenome; day 119 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 46 |
End posion on genome | 121 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acgcaatatg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCACGGGATTGTGATTCCCGGTGTCGTGGGTTCGAGA |
Downstream region at tRNA end position |
tattttgaaa |
Secondary structure (Cloverleaf model) | >WENV170012805 His GTG g CCCA tattttgaaa G - C T - A G - C G - C G + T C - G G - C A G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC C - G G - C G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |