Sequence ID | >WENV170012841 |
Genome ID | ASRP01000803 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 1 |
End posion on genome | 76 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
AGTTCAGTGGCTCAATTGGTAGAGTAACGGTCTCCAAAACCGTGGGTTTAGGGTTCGAGT |
Downstream region at tRNA end position |
taataaattt |
Secondary structure (Cloverleaf model) | >WENV170012841 Trp CCA n GCCA taataaattt A - T G - C T - A T + G C - G A - T G - C T G T A T C C C A T A A G | | | | | G T C T C G T A G G G C G | | | + T T G G A G T T A A GGGTT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |