Sequence ID | >WENV170012853 |
Genome ID | ASRP01002642 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 865 |
End posion on genome | 778 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
attgagcagt |
tRNA gene sequence |
GGTGAGATGGTCGAGTGGTCGAAGGCGCATGCCTGGAACGTATGTGTAGTTTATTCTACC |
Downstream region at tRNA end position |
tttataaaaa |
Secondary structure (Cloverleaf model) | >WENV170012853 Ser GGA t GCCA tttataaaaa G - C G + T T - A G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | G G G C T G G A G G G C G | + | T T T A G G C C G A G TGTAGTTTATTCTACC C - G A - T T - A G + T C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |