Sequence ID | >WENV170012864 |
Genome ID | ASRP01003336 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 231 |
End posion on genome | 306 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tttaccttat |
tRNA gene sequence |
GGGGACGTAGCTCAGCTGGGAGAGCACAACGCTGGCAGCGTTGGGGTCGTCGGTTCGAAC |
Downstream region at tRNA end position |
tcaaaattac |
Secondary structure (Cloverleaf model) | >WENV170012864 Ala GGC t ACCA tcaaaattac G - C G - C G + T G - C A - T C - G G - C C A T T A G C C A C G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A A GGGTC C - G A - T A - T C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |