Sequence ID | >WENV170012885 |
Genome ID | ASRP01008706 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 311 |
End posion on genome | 386 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cattactaat |
tRNA gene sequence |
GGGGCTATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCTGCGGTTCGATC |
Downstream region at tRNA end position |
tctttaagtg |
Secondary structure (Cloverleaf model) | >WENV170012885 Ala TGC t ACCA tctttaagtg G - C G - C G + T G - C C - G T - A A - T C T T A C G C C A C G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |