Sequence ID | >WENV170012911 |
Genome ID | ASRP01021159 |
Phylum/Class | [ASRP] bioreactor metagenome; day 140 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 185 |
End posion on genome | 111 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
attctaactg |
tRNA gene sequence |
GGGCGCATAGCTCAGCCGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
ggaaacaatg |
Secondary structure (Cloverleaf model) | >WENV170012911 Ile GAT g ACtc ggaaacaatg G - C G - C G - C C - G G + T C - G A - T T G T T C A C C A C G A A + | | | | G C C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |