Sequence ID | >WENV170013001 |
Genome ID | ASRQ01003793 |
Phylum/Class | [ASRQ] bioreactor metagenome; day 168 sample from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 232 |
End posion on genome | 161 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agtttaataa |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGATTC |
Downstream region at tRNA end position |
taaaatatat |
Secondary structure (Cloverleaf model) | >WENV170013001 Glu TTC a Attt taaaatatat G - C G + T C - G C - G C - G G - C T - A T T T T C C C C A C G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |