Sequence ID | >WENV170013021 |
Genome ID | ASRR01000161 |
Phylum/Class | [ASRR] bioreactor metagenome; day 185 samples from continuous culture bioreactor inoculated with sediment from the German Wadden |
Species | |
Start position on genome | 5542 |
End posion on genome | 5468 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
accgtggtat |
tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGAGAGTTCAATTC |
Downstream region at tRNA end position |
ttcctctttt |
Secondary structure (Cloverleaf model) | >WENV170013021 Thr GGT t ACCA ttcctctttt G - C C - G T - A G - C C - G C - G G + T T T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |