Sequence ID | >WENV170013089 |
Genome ID | ATLU01000003 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 168013 |
End posion on genome | 167937 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gcctccgcgc |
tRNA gene sequence |
GGTCCCGTGGCTCAACTGGATAGAGCAGCCCCCTCCTAAGGGGCAGGTTGCAGGTTCGAA |
Downstream region at tRNA end position |
atctcttccg |
Secondary structure (Cloverleaf model) | >WENV170013089 Arg CCT c GCCA atctcttccg G - C G + T T - A C - G C - G C - G G - C T A T C G T C C A C A A G | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTT G - C C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |