Sequence ID | >WENV170013093 |
Genome ID | ATLU01000008 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 44099 |
End posion on genome | 44023 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gccccaaggt |
tRNA gene sequence |
GGGCCTGTAGCTCAATTGGTTAGAGCAGAGCGCTCATAACGCTTTGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
cctctcttgc |
Secondary structure (Cloverleaf model) | >WENV170013093 Met CAT t ACCA cctctcttgc G + T G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTT G + T A - T G - C C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |