Sequence ID | >WENV170013097 |
Genome ID | ATLU01000011 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 92806 |
End posion on genome | 92882 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
agaccaatat |
tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTAGAGCACTGCCTTCGGGAGGCAGGGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
gttgaactta |
Secondary structure (Cloverleaf model) | >WENV170013097 Pro CGG t ACCA gttgaactta C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A C G A A + | | | | G C C T C G G G A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C C - G C - G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |