Sequence ID | >WENV170013120 |
Genome ID | ATLU01000031 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 74600 |
End posion on genome | 74525 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
atccgctcaa |
tRNA gene sequence |
GGGGCGTTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
acgttctgtt |
Secondary structure (Cloverleaf model) | >WENV170013120 Ala TGC a ACCA acgttctgtt G - C G - C G + T G - C C - G G - C T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |