Sequence ID | >WENV170013159 |
Genome ID | ATLU01000116 |
Phylum/Class | [ATLU] bioreactor metagenome; continuous culture bioreactor inoculated with sediment procaryotes from the German |
Species | |
Start position on genome | 4832 |
End posion on genome | 4758 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tacagaatat |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGCCAGGCACCTGGTTTTGATCCAGGCATACGTAGGTTCGAATC |
Downstream region at tRNA end position |
tatttaagtg |
Secondary structure (Cloverleaf model) | >WENV170013159 Gln TTG t GCCA tatttaagtg T - A G - C G - C G - C G - C C - G G - C T A T C A T C C A G A C | | | | | G C A C C G G T A G G C G | | | T T G A G G C C C A CATAC C - G C - G T - A G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |